Transposon
Name: IS1326
Family: IS21
Evidence of Transposition: no
 Host     

Host Organism:Salmonella enterica subsp. enterica serovar Paratyphi B Molecular Source:plasmid R1

 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 26 bp)TGTTGAGTTGCATCTAAAATTGACCC
IRR (Length: 26 bp)TGTTGATTTGCACCCAAATTTGACCC

 Sequence     
DNA SequenceLength  2470 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
TGTTGAGTTG CATCTAAAAT TGACCCACTT AGGGTAAAGA TTTGCGTCGA AATTTGACCC ACGTATGACA CTGTTTCCCG TCTGGATATG GCGGGAGAAA 100
TCAAGGAGTG ATAAACGTGG CGATATTGAG CGCAATTCGA CGCTGGCATT TTCGCGATGG TGCGTCGATT CGGGAAATAG CCCGACGAAG CGGCCTGTCC 200
AGGAACACCG TTCGCAAGTA TTTGCAAAGC AAGGTGGTTG AACCGCAGTA CCCAGCGCGA GACAGCGTTG GCAAGTTAAG TCCTTTTGAG CCCAAGTTAA 300
GGCAGTGGCT CTCCACCGAG CACAAAAAGA CAAAGAAGCT GCGCAGAAAC CTGCGCAGCA TGTACCGGGA TTTGGTCGCT TTGGGCTTTA CCGGGTCTTA 400
TGACCGAGTG TGTGCCTTTG CCCGACAGTG GAAAGATTCC GAACAGTTCA AGGCGCAAAC CTCGGGCAAG GGTTGTTTCA TCCCCTTGCG CTTTGCTTGT 500
GGCGAAGCCT TCCAATTCGA TTGGAGTGAG GACTTTGCCC GCATAGCGGG CAAACAGGTC AAACTTCAGA TTGCCCAGTT TAAGTTGGCC CACAGCCGGG 600
CCTTTGTGCT TCGGGCTTAC TACCAGCAAA AACATGAAAT GCTGTTTGAT GCCCACTGGC ATGCCTTTCA AATCTTCGGT GGCATTCCCA AGCGCGGCAT 700
CTACGACAAC ATGAAGACCG CTGTGGATTC GGTGGGGCGT GGCAAAGAGC GCAGGGTCAA TCAGCGGTTC ACTGCCATGG TCAGCCACTA CCTGTTTGAT 800
GCGCAGTTCT GTAATCCAGC ATCGGGTTGG GAGAAAGGCC AGATTGAGAA GAACGTGCAG GATTCCCGCC AACGCCTGTG GCAAGGGGCA CCAGACTTTC 900
AAAGCCTTGC TGATTTGAAT GTGTGGCTTG AGCATCGCTG CAAAGCGCTG TGGTCTGAGC TGCGCCACCC CGAATTGGAC CAAACCGTGC AAGAGGCCTT 1000
TGCCGATGAA CAAGGCGAGT TGATGGCGCT ACCCAATGCC TTTGATGCAT TCGTGGAGCA AACCAAGCGA GTCACTTCAA CCTGCCTTGT TCACCACGAG 1100
GGCAATCGCT ACAGCGTTCC TGCCAGTTAC GCCAACAGGG CCATCAGCCT TCGGATTTAT GCAGACAAGC TGGTGATGGC TGCCGAAGGC CAACACATTG 1200
CCGAGCATCC AAGATTGTTT GGCAGTGGCC ACGCTCGGCG TGGCCACACA CAATACGACT GGCACCATTA CTTGTCTGTG CTTCAGAAGA AACCTGGGGC 1300
GTTGCGCAAT GGTGCGCCAT TTGCTGAATT GCCACCCGCG TTCAAGAAGC TTCAATCCAT CTTGCTGCAA CGCCCCGGCG GTGACCGTGA CATGGTGGAA 1400
ATTCTGGCCC TTGTATTGCA CCACGATGAA GGTGCGGTAC TCAGTGCTGT GGAATTGGCA TTGGAGTGTG GCAAGCCATC GAAGGAGCAT GTGCTTAATC 1500
TGTTGGGACG TTTGACCGAA GAACCTCCAC CCAAACCGAT TCCAATTCCC AAGGGGTTAA GGCTGACATT GGAACCACAG GCCAACGTGA ACCGCTATGA 1600
CAGTTTAAGG AGAGCCCATG ATGCAGCATG AAGGCCATGT GAGAATCCTC AAATCCTTGA AACTCTTTGG CATGGCACAC GCCATTGAGG AGTTGGGCAA 1700
TCAGAATTCA CCAGCATTTA ATCAAGCCTT GCCCATGCTG GACAGCTTGA TTAAAGCTGA AGTGGCAGAG CGTGAAGTAC GTTCGGTGAA CTATCAATTG 1800
CGGGTGGCCA AGTTCCCCGT GTATCGGGAC TTGGTGGGCT TTGACTTCAG TCAAAGCCTG GTTAATGAGG CCACGGTCAA ACAATTGCAC CGGTGCGACT 1900
TCATGGAACA AGCCCAGAAC GTGGTGCTGA TTGGTGGGCC AGGCACAGGC AAGACTCACC TGGCCACAGC CATTGGTACA CAAGCAGTGA TGCACTTGAA 2000
CCGACGGGTG CGTTTCTTCT CCACCGTGGA TTTGGTCAAT GCACTGGAGC AAGAGAAATC ATCTGGGCGT CAGGGACAAA TCGCAAACCG TCTGTTGTAT 2100
GCCGATTTGG TGATTCTGGA TGAGCTGGGA TATTTGCCTT TTAGCCAAAC CGGTGGGGCA CTGCTGTTTC ACCTGCTCTC AAAGCTGTAC GAAAAAACCA 2200
GCGTGATACT GACCACCAAC TTGAGCTTCT CGGAATGGAG CCGAGTGTTT GGCGATGAAA AGATGACAAC AGCGTTGTTG GACCGACTAA CCCACCACTG 2300
CCACATCCTG GAAACCGGCA ATGAAAGTTA CCGCTTCAAA CACAGTTCAA CTCAGAATAA GCAGGAGGAA AAACAGACCC GCAAACTGAA AATCGAGACA 2400
TAATTCTGAC AACAAGGGGT GGGTCAAAAT TCAATGCAAA TCCCGGGTCA AATTTGGGTG CAAATCAACA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
istA IS1326 108-1631 Transposase   +
istB IS1326 1618-2403 Accessory Gene ATPase Transposition Helper +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istA IstA IS1326 1524 108-1631 +
Class:   Transposase
Transpoase Chemistry:   DDE
Protein Sequence:  
MINVAILSAI RRWHFRDGAS IREIARRSGL SRNTVRKYLQ SKVVEPQYPA RDSVGKLSPF EPKLRQWLST EHKKTKKLRR NLRSMYRDLV ALGFTGSYDR
VCAFARQWKD SEQFKAQTSG KGCFIPLRFA CGEAFQFDWS EDFARIAGKQ VKLQIAQFKL AHSRAFVLRA YYQQKHEMLF DAHWHAFQIF GGIPKRGIYD
NMKTAVDSVG RGKERRVNQR FTAMVSHYLF DAQFCNPASG WEKGQIEKNV QDSRQRLWQG APDFQSLADL NVWLEHRCKA LWSELRHPEL DQTVQEAFAD
EQGELMALPN AFDAFVEQTK RVTSTCLVHH EGNRYSVPAS YANRAISLRI YADKLVMAAE GQHIAEHPRL FGSGHARRGH TQYDWHHYLS VLQKKPGALR
NGAPFAELPP AFKKLQSILL QRPGGDRDMV EILALVLHHD EGAVLSAVEL ALECGKPSKE HVLNLLGRLT EEPPPKPIPI PKGLRLTLEP QANVNRYDSL
RRAHDAA

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
istB IstB IS1326 786 1618-2403 +
Class:   Accessory Gene
Sub Class:   ATPase Transposition Helper
Function:   stimulates transposition
Protein Sequence:  
MMQHEGHVRI LKSLKLFGMA HAIEELGNQN SPAFNQALPM LDSLIKAEVA EREVRSVNYQ LRVAKFPVYR DLVGFDFSQS LVNEATVKQL HRCDFMEQAQ
NVVLIGGPGT GKTHLATAIG TQAVMHLNRR VRFFSTVDLV NALEQEKSSG RQGQIANRLL YADLVILDEL GYLPFSQTGG ALLFHLLSKL YEKTSVILTT
NLSFSEWSRV FGDEKMTTAL LDRLTHHCHI LETGNESYRF KHSSTQNKQE EKQTRKLKIE T

 References