Transposon
Name: IS1133
Family: IS3        Group: IS3
Evidence of Transposition: ND
 Map     



 Terminal Inverted Repeats (IR)     

IRL (Length: 27 bp)TGGACTTGCCTCGGTTTCGTTCCGGTC
IRR (Length: 27 bp)TGGACTTGCACCGGTTGTGTTCCGGTC

 Sequence     
DNA SequenceLength  1232 
--------10 --------20 --------30 --------40 --------50 --------60 --------70 --------80 --------90 -------100
TGGACTTGCC TCGGTTTCGT TCCGGTCTTT TTGAGAGCAT TATTTGTTAT CAAGGAGACC ATATATGTCA TTAAAGCATA GTGATGAATT TAAGCGTGAT 100
GCAGTTCGCA TAGCACTCAC TAGTGGCTTA ACACGCCGTC AAGTTGCGTC AGATTTAAGT ATTGGGCTTT CCACGCTTGG GAAATGGATC GCATCAATTT 200
CCGATGAAAC TAAAATTCCT ACCCAAGACA CTGATCTTCT GCGTGAGAAT GAACGTTTAC GCAAAGAGAA CCGTATCCTT CGGGAGGAGA GGGAGATATT 300
AAAAAAGGCA GCAATATTTT TCGCAGTACA AAAGCTGTGA GATTTCAGTT TATTACGGAT TACCGTGGCT CTCTCTCACG TTCACGCATA TGTCGTTTGA 400
TGGGCGTAAC AGATCGTGGT TTACGTGCAT GGAAACGCCG TCCTCCATCA CTGCGCCAGC GTCGTGATCT TATACTTCTA GCGCATATAC GTGAGCAGCA 500
TCGGTTGTGT TTGGGGAGCT ATGGTAGGCC GCGTATGACA GAAGAGTTGA AAGCGCTGGG CCTGCAGGTT GGGCAGCGTC GGGTTGGACG TTTGATGCGC 600
CAGAATAACA TTACAGTTGT TCGAACGCGT AAATTCAAAC GGACAACGGA TAGTCATCAT ACCTTCAACA TTGCACCGAA CCTATTAAAA CAAGACTTTA 700
GCGCAAGCGC ACCCAACCAG AAATGGGCAG GCGATATCAC TTATGTTTGG ACCAGAGAAG GATGGGTCTA TCTTGCTGTT ATCCTTGACC TGTATTCCCG 800
TCGCGTGATT GGCTGGGCAA CAGGTGATCG ATTAAAGCAG GATCTTGCAT TAAGGGCACT GAATATGGCG TTGGCTTTAC GCAAACCACC ACCGGGTTGT 900
ATTCAACACA CAGACCGTGG GAGCCAATAT TGCGCTCATG AATATCAAAA GCTACTGCTC AAACATCAAT TGCTGCCGTC CATGAGCGGG AAAGGCAATT 1000
GTTTTGATAA CTCCGCAGTA GAAAGCTTCT TTAAATCATT AAAGGCTGAG TTGATTTGGC GCAGACACTG GCAAACAAGG CGAGATATTG AGATTGCAAT 1100
CTTCGAATAT ATAAATGGCT TTTATAATCC ACGCCGAAGA CATTCAACAC TCGGCTGGAA ATCGCCGGTG GCATTTGAGA AAAAAGCCGC TTAAAATGAG 1200
AGATAGACCG GAACACAACC GGTGCAAGTC CA

 ORFs     
ORF Summary
Gene Name Associated TE Coordinates Class Sub Class Orientation
orfAB IS1133 65-1194 Transposase   +
orfA IS1133 65-340 Accessory Gene Regulator +
orfB IS1133 337-1194 Transposase   +

ORF Details
Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfAB OrfAB IS1133 1130 65-1194 +
Class:   Transposase
Transpoase Chemistry:   DDE
Comment:   fusion protein from -1 programmed frameshifting between orfA and orfB
Protein Sequence:  
MSLKHSDEFK RDAVRIALTS GLTRRQVASD LSIGLSTLGK WIASISDETK IPTQDTDLLR ENERLRKENR ILREEREILK KAAIFFAVQK L*DFSLLRIT
VALSHVHAYV V*WA*QIVVY VHGNAVLHHC ASVVILYF*R IYVSSIGCVW GAMVGRV*QK S*KRWACRLG SVGLDV*CAR ITLQLFERVN SNGQRIVIIP
STLHRTY*NK TLAQAHPTRN GQAISLMFGP EKDGSILLLS LTCIPVA*LA GQQVID*SRI LH*GH*IWRW LYANHHRVVF NTQTVGANIA LMNIKSYCSN
INCCRP*AGK AIVLITPQ*K ASLNH*RLS* FGADTGKQGE ILRLQSSNI* MAFIIHAEDI QHSAGNRRWH LRKKPL

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfA OrfA IS1133 276 65-340 +
Class:   Accessory Gene
Sub Class:   Regulator
Function:   transposase activity (GO:0004803)
Comment:   orfA, together with orfB, encodes a fusion protein formed by translational frame-shifting that is the transposase for IS1133
Protein Sequence:  
MSLKHSDEFK RDAVRIALTS GLTRRQVASD LSIGLSTLGK WIASISDETK IPTQDTDLLR ENERLRKENR ILREEREILK KAAIFFAVQK L

Gene Name Protein Name Associated TE Gene Length Coordinates Strand
orfB OrfB IS1133 858 337-1194 +
Class:   Transposase
Function:   transposase activity (GO:0004803)
Transpoase Chemistry:   DDE
Comment:   orfB, together with orfA, encodes a fusion protein formed by translational frame-shifting that is the transposase for IS1133
Protein Sequence:  
MRFQFITDYR GSLSRSRICR LMGVTDRGLR AWKRRPPSLR QRRDLILLAH IREQHRLCLG SYGRPRMTEE LKALGLQVGQ RRVGRLMRQN NITVVRTRKF
KRTTDSHHTF NIAPNLLKQD FSASAPNQKW AGDITYVWTR EGWVYLAVIL DLYSRRVIGW ATGDRLKQDL ALRALNMALA LRKPPPGCIQ HTDRGSQYCA
HEYQKLLLKH QLLPSMSGKG NCFDNSAVES FFKSLKAELI WRRHWQTRRD IEIAIFEYIN GFYNPRRRHS TLGWKSPVAF EKKAA

 References     

1.Siguier P, Varani A, Perochon J, Chandler M. Exploring bacterial insertion sequences with ISfinder: objectives, uses, and future developments. Methods Mol Biol. 2012;859:91-103. doi: 10.1007/978-1-61779-603-6_5. PubMed ID: 22367867
2.Blot M, Hauer B, Monnet G. The Tn5 bleomycin resistance gene confers improved survival and growth advantage on Escherichia coli. Mol Gen Genet. 1994 Mar;242(5):595-601. doi: 10.1007/BF00285283. PubMed ID: 7510018
3.Yuasa K, Sugiyama M. Bleomycin-induced beta-lactamase overexpression in Escherichia coli carrying a bleomycin-resistance gene from Streptomyces verticillus and its application to screen bleomycin analogues. FEMS Microbiol Lett. 1995 Oct 1;132(1-2):61-6. doi: 10.1111/j.1574-6968.1995.tb07811.x. PubMed ID: 7590166
4.Reznikoff WS. The Tn5 transposon. Annu Rev Microbiol. 1993;47:945-63. doi: 10.1146/annurev.mi.47.100193.004501. PubMed ID: 7504907