ISH24

  • Family ISNCY
  • Group
MGE type ISRelated element(s) :
Isoform Synonym(s) ISH7
Accession numberTranspositionOriginHost
Y Halobacterium salinarum
Halobacterium tunesiensis A2
Halobacterium salinarum R1
Halobacterium salinarum PHH1 plasmid pHH1
Halobacterium salinarum NRC34020
Halobacterium salinarum NRL
DNA section
IS Length : 3000 bp

Ends


IR Length : 10

IRL :
IRR :

Insertion site


Left flankDirect repeatRight flankDR Length
ATGAGCACCGCCCACGAGGCAAGCGTG7

DNA sequence

Protein section
ORF number : 0

 

Comments
ISH24 is associated with the inactivation of the bacteriorhodopsin (bop) gene. Sequencing of ISH24 is under way (Pfeifer, 1993).
References
1] Pfeifer, F., Betlach, M., Martienssen, R., Friedman, J., and Boyer, H.W. (1983) Mol. Gen. Genet. 191, 182-188.
2] Pfeifer, F., Friedman, J., Boyer, H.W., and Betlach, M. (1984) Nucl. Acids Res. 12, 2489-2497.
3] Pfeifer, F. (1986) System. Appl. Microbiol. 7, 36-40.
4] Pfeifer, F., Blaseio, U., and Ghahraman, P. (1988) J. Bacteriol. 170, 3718-3724.
5] Pfeifer, F., Blaseio, U., and Horne, M. (1989) Can. J. Microbiol. 35, 96-100.
6] Pfeifer, F. (1993) Personal communication.